Persistence of IgG and neutralizing antibodies in Crimean-Congo hemorrhagic fever survivors.

The World Health Organization classified Crimean-Congo hemorrhagic fever (CCHF) as a high-priority infectious disease and emphasized the performance of research studies and product development against it. Little information is available about the immune response due to natural CCHF virus (CCHFV) infection in humans. Here, we investigated the persistence of IgG and neutralizing antibodies in serum samples collected from 61 Iranian CCHF survivors with various time points after recovery (<12, 12-60, and >60 months after disease). The ELISA results showed IgG seropositivity in all samples while a pseudotyped based neutralization assay findings revealed the presence of neutralizing antibody in 29 samples (46.77%). For both IgG and neutralizing antibodies, a decreasing trend of titer was observed with the increase in the time after recovery. Not only the mean titer of IgG (772.80 U/mL) was higher than mean neutralizing antibody (25.64) but also the IgG persistence was longer. In conclusion, our findings provide valuable information about the long-term persistence of humoral immune response in CCHF survivors indicating that IgG antibody can be detected at least 8 years after recovery and low titers of neutralizing antibody can be detected in CCHF survivors.

Dendrosomal nanocurcumin prevents EBV-associated cell transformation by targeting the lytic cycle genes of the Epstein-Barr virus in the generation of lymphoblastoid cell line.

Objectives: Targeting the lytic cycle of the Epstein-Barr virus (EBV) has been considered a new treatment strategy for malignancies caused by this virus. This study aimed to investigate the effect of Dendrosomal NanoCurcumin (DNC) to prevent cell transformation and inhibit the expression of viral lytic gene expression in the generation of lymphoblastoid cell line (LCL). Materials and Methods: Cell viability of LCLs and PBMCs was performed by MTT assay, and flow cytometry (Annexin/PI) was used for evaluation of apoptosis. CD markers on the surface of generated LCL (CD19) cells were examined for cell validation. The effect of DNC on transformation was evaluated by examining cell morphology and determining the expression level of lytic genes BZLF1, Zta, BHRF1, and BRLF1 of EBV using Real-time PCR. Student's t-test was used for statistical analysis. Results: The MTT assay showed that DNC can inhibit the proliferation of LCL in a dose-dependent manner. The 50% cytotoxic concentration (CC50) of DNC and curcumin for LCL was determined 38.8 µg/ml and 75 µg/ml, respectively after 72 hr. Also, Real-time PCR data analysis showed that DNC in 30 µg/ml concentration significantly inhibited cell transformation in the LCL and significantly reduced viral lytic genes such as BZLF1, Zta, BHRF1, and BRLF1expression compared to control. Conclusion: Overall, these findings show that DNC reduces the expression of the viral lytic cycle genes and also the induction of cell apoptosis and finally prevents the generation of LCL.

Efficacy and Safety of a Protein-Based SARS-CoV-2 Vaccine: A Randomized Clinical Trial.

Importance: The protein-based SARS-CoV-2 vaccines FINLAY-FR-2 (Soberana 02) and FINLAY-FR-1A (Soberana Plus) showed good safety and immunogenicity in phase 1 and 2 trials, but the clinical efficacy of the vaccine remains unknown. Objective: To evaluate the efficacy and safety of a 2-dose regimen of FINLAY-FR-2 (cohort 1) and a 3-dose regimen of FINLAY-FR-2 with FINLAY-FR-1A (cohort 2) in Iranian adults. Design, Setting, and Participants: A multicenter, randomized, double-blind, placebo-controlled, phase 3 trial was conducted at 6 cities in cohort 1 and 2 cities in cohort 2. Participants included individuals aged 18 to 80 years without uncontrolled comorbidities, coagulation disorders, pregnancy or breastfeeding, recent immunoglobulin or immunosuppressive therapy, and clinical presentation or laboratory-confirmed COVID-19 on enrollment. The study was conducted from April 26 to September 25, 2021. Interventions: In cohort 1, 2 doses of FINLAY-FR-2 (n = 13 857) or placebo (n = 3462) were administered 28 days apart. In cohort 2, 2 doses of FINLAY-FR-2 plus 1 dose of FINLAY-FR-1A (n = 4340) or 3 placebo doses (n = 1081) were administered 28 days apart. Vaccinations were administered via intramuscular injection. Main Outcomes and Measures: The primary outcome was polymerase chain reaction-confirmed symptomatic COVID-19 infection at least 14 days after vaccination completion. Other outcomes were adverse events and severe COVID-19. Intention-to-treat analysis was performed. Results: In cohort 1 a total 17 319 individuals received 2 doses and in cohort 2 5521 received 3 doses of the vaccine or placebo. Cohort 1 comprised 60.1% men in the vaccine group and 59.1% men in the placebo group; cohort 2 included 59.8% men in the vaccine group and 59.9% in the placebo group. The mean (SD) age was 39.3 (11.9) years in cohort 1 and 39.7 (12.0) years in cohort 2, with no significant difference between the vaccine and placebo groups. The median follow-up time in cohort 1 was 100 (IQR, 96-106) days and, in cohort 2, 142 (137-148) days. In cohort 1, 461 (3.2%) cases of COVID-19 occurred in the vaccine group and 221 (6.1%) in the placebo group (vaccine efficacy: 49.7%; 95% CI, 40.8%-57.3%) vs 75 (1.6%) and 51 (4.3%) in cohort 2 (vaccine efficacy: 64.9%; 95% CI, 49.7%-59.5%). The incidence of serious adverse events was lower than 0.1%, with no vaccine-related deaths. Conclusions and Relevance: In this multicenter, randomized, double-blind, placebo-controlled, phase 3 trial of the efficacy and safety of FINLAY-FR-2 and FINLAY-FR-1A, 2 doses of FINLAY-FR-2 plus the third dose of FINLAY-FR-1A showed acceptable vaccine efficacy against symptomatic COVID-19 as well as COVID-19-related severe infections. Vaccination was generally safe and well tolerated. Therefore, Soberana may have utility as an option for mass vaccination of the population, especially in resource-limited settings, because of its storage condition and affordable price. Trial Registration: isrctn.org Identifier: IRCT20210303050558N1.

SARS-CoV-2 in domestic cats (Felis catus) in the northwest of Iran: Evidence for SARS-CoV-2 circulating between human and cats.

This study aimed to investigate the prevalence of COVID-19 in domestic cats, focusing on the disease in the northwest of Iran and then showing the natural transmission of SARS-COV-2 circulating between domestic cats and humans. After receiving ethic codes from Tehran University of Medical Sciences (IR.TUMS.VCR.REC.1399.303) and confirmed by the Center of Communicable Diseases Control (CDC) of Iran, 124 domestic cats were collected from the homes and only one hospital of Meshkin -Shahr district from northwestern Iran where SARS-CoV-2 patients were hospitalized and quarantined during 2020. Samples were prepared from fluid materials of oropharynx and nasopharynx. All samples were tested by real-time PCR (RT-PCR) using specific genes N and ORF1ab in Pasteur Institute of Iran, and then partial sequence analyses of S gene were performed. All collected cats were kept in separated cages until SARS-COV-2 infection was confirmed with the RT-PCR. RT- PCR Ct values of 123 collected cats were ≥40; thus, all of them showed negative results, but one of the collected cats with close contact with its owner, whom confirmed SARS-CoV-2 showed positive results with gene N(Ct=30) and gene ORF1ab (Ct=32). Furthermore, the positive pet cat showed respiratory and gastro-intestinal clinical manifestations, and its owner was infected with SARS-CoV-2 two weeks ago. Cats are susceptible animals to SARS-CoV-2 infection. Epidemiological evidence showed that SARS-COV-2 is able to transmit to healthy cats due to having close contact with its owner as a reverse zoonosis.

The ins and outs of SARS-CoV-2 variants of concern (VOCs).

SARS-CoV-2, a newly emerging coronavirus that caused the COVID-19 epidemic, has been spreading quickly throughout the world. Despite immunization and some fairly effective therapeutic regimens, SARS-CoV-2 has been ravaging patients, health workers, and the economy. SARS-CoV-2 mutates and evolves to adapt to its host as a result of extreme selection pressure. As a consequence, new SARS-CoV-2 variants have emerged, some of which are classified as variants of concern (VOC) because they exhibit greater transmissibility, cause more-severe disease, are better able to escape immunity, or cause higher mortality than the original Wuhan strain. Here, we introduce these VOCs and review their characteristics, such as transmissibility, immune escape, mortality risk, and diagnostics.

Corrigendum to 'How Iran responded to expanding need for laboratory services for COVID-19?'

[This corrects the article DOI: 10.1016/j.hlpt.2021.100506.].

SARS-CoV-2 re-infection rate in Iranian COVID-19 cases within one-year follow-up.

Since the COVID-19 pandemic initiation, the possibility of re-infection has been unclearly present. Although herd immunity has a potential reliance through natural infection, human corona viruses has the ability to subvert immunity and re-infection happens for seasonal corona viruses. Currently, the frequency of SARS-CoV-2 re-infection incidence is not exactly defined. In this study we aimed at determination of SARS-CoV-2 re-infection rate in Iranian population. In a total of 5696 COVID-19 suspicious individuals, RT-PCR was applied to diagnose the infection. The confirmed patients were followed for 12 months and serology tests were applied to measure the specific antibodies. Among 1492 confirmed COVID-19 cases, five individuals experienced the subsequent infection. The re-infection/reactivation incidence rate was totally 0.33% after one year of follow-up. The interval ranged from 63 to 156 days. All the cases had viral mutations in the second episode of the infection. All of them were symptomatic cases with moderate severity. The estimated rate of SARS-CoV-2 in Persian population is therefore rare and natural infection seems to induce good protection against re-infection which clarifies that mass vaccination can hugely affect the society.

Antiviral Therapeutic Potential of Curcumin: An Update.

The treatment of viral disease has become a medical challenge because of the increasing incidence and prevalence of human viral pathogens, as well as the lack of viable treatment alternatives, including plant-derived strategies. This review attempts to investigate the trends of research on in vitro antiviral effects of curcumin against different classes of human viral pathogens worldwide. Various electronic databases, including PubMed, Scopus, Web of Science, and Google Scholar were searched for published English articles evaluating the anti-viral activity of curcumin. Data were then extracted and analyzed. The forty-three studies (published from 1993 to 2020) that were identified contain data for 24 different viruses. The 50% cytotoxic concentration (CC50), 50% effective/inhibitory concentration (EC50/IC50), and stimulation index (SI) parameters showed that curcumin had antiviral activity against viruses causing diseases in humans. Data presented in this review highlight the potential antiviral applications of curcumin and open new avenues for further experiments on the clinical applications of curcumin and its derivatives.

Evidence of Hantavirus circulation among municipal street sweepers, southwest of Iran.

Hantaviruses are rodent-borne zoonosis pathogens that cause hemorrhagic fever with renal syndrome (HFRS) and Hantavirus cardiopulmonary syndrome (HCPS) in humans. Rodents spread the virus via their excretions. The outbreak of Hantaviruses pose a significant public health problem. The epidemiology and history of Hantaviruses in Iran is not clear and regardless of the data from the few available studies, little is known about its epidemiology in this country. Herein, we discuss the prevalence of IgG antibody against Hantavirus serotypes in 385 street sweepers from southwest of Iran. Serum samples were investigated, using Hantavirus Pool 1 "Eurasia" IgG kit and Pool 2 "America" ELISA IgG kit (Euroimmun, Germany) to detect IgG antibodies against Old and New World Hantaviruses. The results showed a specific IgG antibody in two samples (0.5%). Both of seropositive cases had specific IgG antibody against Old World Hantaviruses. The data of the current study along with the previous data, indicate the circulation of Hantaviruses in Iran. Hence, the risk of Hantavirus infection in high-risk groups should be considered as a serious health issue.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

SARS-CoV-2 presented moderately during two episodes of the infection with lack of antibody responses.

The world has gone through the critical phase of SARS-CoV-2 crisis caused by the new variants of the virus. The globally concerted effort to characterize viral genomic mutations across different clades has revealed several changes in the coding and also non-coding regions which might lead to a violent presentation or re-infection occurrence. Here, we studied a COVID-19 subject who represented the symptoms following the full recovery of the first infection. COVID-19 specific IgM and IgG were evaluated in both steps. The viral samples from oropharyngeal/nasopharyngeal were subjected to RT-PCR and full sequencing was done in both incidences. The sequencing data was fully investigated with the reference sequence of SARS-CoV-2 and the changes were detected. The obtained data is in favor of re-infection with 128 days of interval. SARS-CoV-2 presented more severely in the second episode of the disease and the specific antibodies against COVID-19 were not detectable. Both infections were caused by the same clade 20G, however, the mutation rates were higher in the second incidence including 10 nucleotide substitutions which had rarely been reported before. In the present study, the nucleotide mutations in various regions of the viral genome have been presented. The re-infection could have significant effect on clinical implications as well as vaccination.

Evaluation of transduced dendritic cells expressing HIV-1 p24-Nef antigens in HIV-specific cytotoxic T cells induction as a therapeutic candidate vaccine.

Various approaches have been investigated to prevent or eliminate HIV-1 since 1981. However, the virus has been affecting human population worldwide with no effective vaccine yet. The conserved regions among the viral genes are suitable targets in mutable viruses to induce the immune responses via an effective delivery platform. In this study, we aimed at evaluation of p24 and nef in two forms of full and truncated genes as two fusion antigenic forms according to our previous bioinformatics analysis. The designed antigens were then transferred through ex vivo generated dendritic cells and also proteins in BALB/c to assess and compare immunogenicity. p24 and Nef amino acid sequences were aligned, then, the most conserved regions were selected and two fusion forms as the truncated (p24:80-231aa-Nef:120-150aa) and the full from (p24-Nef) were cloned and expressed in prokaryotic and eukaryotic systems. Lentiviral vectors were applied to generate recombinant virions harboring the genes of interest to transduce generated murine dendritic cells. BALB/c mice received the recombinant DCs or recombinant proteins according to the defined schedule. IgG development was assessed to determine humoral immune activity and cellular immune responses were evaluated by IL-5 and IFN-y induction. Granzyme B secretion was also investigated to determine CTL activity in different immunized groups. The data showed high induction of cellular immune responses in dendritic cell immunization specifically in immunized mice with the truncated form of the p24 and Nef by high secretion of IFN-y and strong CTL activity. Moreover, protein/ DC prime-boost formulation led to stronger Th1 pathway and strong CTL activation in comparison with other formulations. The generated recombinant dendritic cells expressing p24-Nef induced humoral and cellular immunity in a Th1 pathway specifically with the in silico predicted truncated antigen which could be of high value as a dendritic cell therapeutic vaccine candidate against HIV-1.

Prolonged viral shedding and antibody persistence in patients with COVID-19.

SARS-CoV-2 as a new global threat has affected global population for one year. Despite the great effort to eradicate this infection, there are still some challenges including different viral presentation, temporal immunity in infected individuals and variable data of viral shedding. We studied 255 COVID-19 suspected individuals to assess the viral shedding duration and also the antibody development against SARS-CoV-2 among the cases. Real Time RT-PCR assay was applied to determine the virus presence and SARS-CoV-2 antibodies were evaluated using SARS-CoV-2 IgM and IgG kits. 113 patients were confirmed for COVID-19 infection. The patients were followed until negative PCR achieved. The median viral shedding among studied population was obtained 34.16 (±17.65) days which was not significantly associated with age, sex and underlying diseases. Shiver and body pain were found in prolonged form of the infection and also patients who had gastrointestinal problems experienced longer viral shedding. Moreover, IgG was present in 84% of patients after 150 days. According to this data, the median viral shedding prolongation was 34.16 days which indicates that 14 days isolation might not be enough for population. In addition, IgG profiling indicated that it is persistent in a majority of patients for nearly 6 months which has brought some hopes in vaccine efficacy and application.

Clinical characteristics of SARS-CoV-2 by re-infection vs. reactivation: a case series from Iran.

COVID-19 immunity in infected individuals may not be persistent. The specific response wanes in patients who have recovered from this infection. Nevertheless, it has not been fully understood whether true re-infection occurs or the viral reactivation. In this study, we investigated three COVID-19 patients who represented the symptoms after recovery. Chest CT scan was applied to assess the patients along with the viral samples from oropharyngeal/nasopharyngeal which were subjected to RT-PCR. The viral genome sequencing was applied where possible to distinguish possible re-infection or latent reactivation. Moreover, COVID-19-specific antibodies available data were evaluated in each incidence. The second episode of SARS-CoV-2 infection was different among the investigated subjects who experienced an interval between positive PCR tests ranged between 63 and 156 days. The disease presentation was less or more severe in the second infection. All cases were found IgG positive in the re-infection phase. The sequencing of SARS-CoV-2 sample obtained from two cases revealed a D614G mutation of S gene from the second isolated sample strengthens the case for the re-infection. The possibility of re-infection and reactivation could have significant effect on clinical implications and also vaccination. Our data supports clear warning of SARS-CoV-2 continuous circulation potency among the populations in spite of herd immunity either with natural infection or vaccination. This issue is critical in term of the patients, clinical investigate, and viral transmission.

Severe acute respiratory syndrome-coronavirus-2 spike (S) protein based vaccine candidates: State of the art and future prospects.

Coronavirus disease 2019 (Covid-19) is caused by severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2) which is responsible for a global pandemic that started in late 2019 in Wuhan, China. To prevent the worldwide spread of this highly pathogenic virus, development of an effective and safe vaccine is urgently needed. The SARS-CoV-2 and SARS-CoV share a high degree of genetic and pathologic identity and share safety and immune-enhancement concerns regarding vaccine development. Prior animal studies with first generation (whole virus-based) preparations of SARS-CoV vaccines (inactivated and attenuated vaccine modalities) indicated the possibility of increased infectivity or eosinophilic infiltration by immunization. Therefore, development of second and third generation safer vaccines (by using modern vaccine platforms) is actively sought for this viral infection. The spike (S) protein of SARS-CoVs is the main determinant of cell entry and tropism and is responsible for facilitating zoonosis into humans and sustained person-to-person transmission. Furthermore, 'S' protein contains multiple neutralizing epitopes that play an essential role in the induction of neutralizing antibodies (nAbs) and protective immunity. Moreover, T-cell responses against the SARS-CoV-2 'S' protein have also been characterized that correlate to the IgG and IgA antibody titres in Covid-19 patients. Thus, S protein is an obvious candidate antigen for inclusion into vaccine platforms against SARS-CoV-2 viral infection. This manuscript reviews different characteristics of S protein, its potency and 'state of the art' of the vaccine development strategies and platforms using this antigen, for construction of a safe and effective SARS-CoV-2 vaccine.

HIV-1 p24-nef DNA Vaccine Plus Protein Boost Expands T-Cell Responses in BALB/c.

BACKGROUND: There have been massive efforts on vaccine development against HIV-1 since its discovery. Various approaches have been taken to attention, including rational vaccine design, optimized delivery systems and heterologous regimen to eradicate the virus. DNA vaccines fundamentally induce host immune responses by genetically engineered plasmids encoding antigens and expressed in vivo without the need of the specific delivery system. Therefore, long-term endogenous antigen expression could be possible. OBJECTIVE: In this study, we aimed at evaluation and comparison of DNA and protein vaccine based on two forms of full and truncated HIV-1 p24-nef antigens by in silico design in BLALB/c. METHODS: The recombinant pcDNA3.1 harboring two sets of HIV-1 p24 and nef genes in truncated and full forms were generated and applied to immunize BALB/c along with the corresponding proteins via three different DNA/DNA, DNA/protein and protein/protein regimens. RESULTS: The results showed that the applied regimens could elicit strong immune responses in comparison with controls and the prim-boost DNA/protein regimen reached the highest immune induction (p < 0.05). Moreover, prime-boost approach was assessed more successfully in a qualitatively broad Th1 response induction. The truncated form of the antigens, p24(80-231 aa)-AAY- Nef (120-150), was evaluated more immunogenic in agreement with the in silico investigation. CONCLUSION: The truncated form of p24-Nef was evaluated highly immunogenic specially when applied in prim-boost DNA/Protein regimen and could be investigated in other delivery systems and a proper animal model to achieve a therapeutic vaccine candidate against HIV-1.

Efficient production of a lentiviral system for displaying Crimean-Congo hemorrhagic fever virus glycoproteins reveals a broad range of cellular susceptibility and neutralization ability.

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne disease with a mortality rate of up to 50% in humans. To avoid safety concerns associated with the use of live virus in virus neutralization assays and to detect human serum neutralizing antibodies, we prepared lentiviral particles containing the CCHF glycoprotein (lenti-CCHFV-GP). Incorporation of the GP into the lentiviral particle was confirmed by electron microscopy and Western blotting. Lenti-CCHFV-GP was found to be able to infect a wide range of cell lines, including BHK-21, HeLa, HepG2, and AsPC-1 cells. In addition, lenti-CCHFV-GP was successfully used as an alternative to CCHFV for the detection of neutralizing antibodies. Sera collected from CCHF survivors neutralized lenti-CCHFV-GP particles in a dose-dependent manner. Our results suggest that the lenti-CCHFV-GP pseudovirus can be used as a safe tool for neutralization assays in low-containment laboratories.

Production of Recombinant HIV-1 p24-Nef Protein in Two Forms as Potential Candidate Vaccines in Three Vehicles.

BACKGROUND: Different approaches have been investigated to develop a preventive or therapeutic vaccine, although none of them has been fully practical. Therapeutic vaccines against HIV-1 have been studied with the aim of eliminating the virus from reservoir cells with or without HAART (Highly Active Antiretroviral Therapy). Fusion proteins with the most immunogenic features among conserved regions can facilitate this achievement in such a variable virus. To achieve the most immunogenic and also conserved regions, bioinformatics tools are widely used to predict antigens' features before applying them. OBJECTIVE: This study aimed at the in vitro evaluation of p24 -Nef fusion protein based on the previous in silico design to achieve a potential therapeutic subunit vaccine against HIV-1. METHODS: The truncated form of p24-Nef using AAY flexible linker and the full protein were expressed and evaluated in the prokaryotic system and confirmed by western blotting. We also used pcDNA3.1 to transfect Lenti-X 293T cells. Moreover, lentiviral vectors were applied to produce recombinant virions harboring the genes of interest and cell transduction. RESULTS: Both fusion proteins in a truncated and a full form were expressed and confirmed by Anti Nef polyclonal antibody in western blotting. Recombinant virions were generated and transduced Lenti-X 293T cells confirming by immunofluorescence microscope and p24 ELISA assay kit. Transduced cells were analyzed by SDS-PAGE and western blotting, which resulted in approved protein expression. CONCLUSION: Fusion protein of p24 and Nef is well expressed in eukaryotic cell lines according to its pre-evaluated features by bioinformatics tools.

Molecular Assay on Detection of Crimean Congo Hemorrhagic Fever (CCHF) Virus in Ixodid Ticks Collected from Livestock in Slaughterhouse from South of Iran.

BACKGROUND: Ticks are vectors of a wide variety of pathogens that can be transmitted to humans, and tick-borne diseases are a significant public health issue worldwide. The present study was carried out on the hard tick infestation of livestock transported to Rafsanjan slaughter house in the southeast of Iran. METHODS: A cross-sectional survey was carried out biweekly from April to September 2016 to determine tick infestation of the meat-producing animals. All the livestock included in our study were thoroughly inspected for the presence of hard ticks on different parts of their bodies. RESULTS: A total of 258 hard ticks were collected from the body of livestock hosts. The ticks that were sampled were classified into two genera and five species: Hyalomma marginatum, Hy. anatolicum, Hy. asiaticum, Hy. dromedarii, and Rhipicephalus sanguineus. Hyalomma dromedarii was the most abundant species in the study area. More than 50 percent of the sampled ticks were collected from the body of camels brought to the slaughter house however molecular analysis showed no Crimean Congo Hemorrhagic Fever (CCHF) virus infection in tick specimens. The Sex ratio of the sampled hard ticks shows that female tick infestation was more common among the study livestock. CONCLUSION: Due to the crucial role of hard ticks in the transmission of different pathogens to humans, additional investigations are necessary to determine the risk of consumption of infested meat-producing animals in the study area.